View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_low_46 (Length: 242)
Name: NF0403_low_46
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0403_low_46 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 21 - 242
Target Start/End: Original strand, 38090086 - 38090307
Alignment:
Q |
21 |
aattctcaatctttttcctgttaagatgcatacaattgtagcatcccttgttccattcttcttagtattccacattctagtaccagtgtcttcttcagat |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38090086 |
aattctcaatctttttcctgttaagatgcatacaattgtagcatcccttgttccattcttcttagtattccacattctagtaccagtgtcttcttcagat |
38090185 |
T |
 |
Q |
121 |
tctgtgatccaacataataatattaataccaataatacccttcttcagtgtctttctctctattcagaatcttctaatccaatctcagaagttacctatt |
220 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38090186 |
tctttgatccaacataataatattaataccaataatacccttcttcagtgtctttctctctattcagaatcttctaatccaatctcagaagttacctatt |
38090285 |
T |
 |
Q |
221 |
tcccaaacacaccttcatattc |
242 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
38090286 |
tcccaaacacaccttcatattc |
38090307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University