View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_low_48 (Length: 209)
Name: NF0403_low_48
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0403_low_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 8 - 160
Target Start/End: Complemental strand, 37571974 - 37571822
Alignment:
Q |
8 |
aaattcggttgaccgggagaacccgtattgttactgctatgcggatattagttactgctaaacggcaatgaaaacttcctatttataacatggtaaccnn |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
37571974 |
aaattcggttgaccgggagaacccgtattgttactgctatgcggatattagttactgctaaacagcaatgaaaacttcctatttataacatggtaaccaa |
37571875 |
T |
 |
Q |
108 |
nnnnntctaaaactattgtaattaaacaatgatcacaaactaattggtgtaaa |
160 |
Q |
|
|
|||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
T |
37571874 |
aaaaatctaaaactattgtgattaaacagtgatcacaaactaattggtgtaaa |
37571822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University