View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0404_low_1 (Length: 416)
Name: NF0404_low_1
Description: NF0404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0404_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 2e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 38059421 - 38059242
Alignment:
| Q |
1 |
ttgctcattccacaatccatgtgtttcaaattttgcttataaatatagattgctcactcttctctattctccttctcata--ccctcaactcaaataggt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38059421 |
ttgctcattccacaatccatgtgtttcaaattttgcttataaatatagattgctcactcttctctattctccttctcatataccctcaactcaaataggt |
38059322 |
T |
 |
| Q |
99 |
gatgcactaaagggtggtctcaagattttgtcttaggtccttctttcactgattcatgtaagttattattcatccttata |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38059321 |
gatgcactaaagggtggtctcaagattttgtcttaggtccttctttcactgattcatgtaagttattattcatccttata |
38059242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 244 - 407
Target Start/End: Complemental strand, 38059176 - 38059013
Alignment:
| Q |
244 |
caacagtttcaatatattatttagcatgaaagttatttataccaagtcagtgctaacctaaaatgcataaccataaaaaactacactagtaatcatgttg |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38059176 |
caacagtttcaatatattatttagcatgaaaattatttataccaagtcagtgctaacctaaaatgcataaccataaaaaactacactagtaatcatgttg |
38059077 |
T |
 |
| Q |
344 |
aggatttannnnnnncttcatatttaactaactataataatttttagtaaaataatagtattat |
407 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38059076 |
aggatttatttttttcttcatatttaactaactataataatttttagtaaaataatagcattat |
38059013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University