View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0404_low_2 (Length: 389)
Name: NF0404_low_2
Description: NF0404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0404_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 74 - 172
Target Start/End: Complemental strand, 14222759 - 14222661
Alignment:
| Q |
74 |
ttgtaagagtgtgagggagtttctagcaaaggtgaaaccaaaagatccgttacttctcatcagaccttgttcccttcctttatctctgtcactaggttc |
172 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14222759 |
ttgtaagagtgtgagggagttcctagcaaaggtgaaaccaaaagatccgttacttctcatcagaccttgttcccttcctttatctctgtcactaggttc |
14222661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 292 - 360
Target Start/End: Complemental strand, 14222405 - 14222337
Alignment:
| Q |
292 |
tgttgtatttggatttttagtctctgtctagctcatgataatatcaaggccctcgaaaaccgttcaaag |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14222405 |
tgttgtatttggatttttagtctctgtctagctcatgataatatcaaggccctcgaaaacccttcaaag |
14222337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 91 - 166
Target Start/End: Complemental strand, 14232584 - 14232509
Alignment:
| Q |
91 |
agtttctagcaaaggtgaaaccaaaagatccgttacttctcatcagaccttgttcccttcctttatctctgtcact |
166 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
14232584 |
agttcctagcagaggtgaaaccaaaagatccgttacttgtcatcagaccttgtttccttgctttatctctgtcact |
14232509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 14222444 - 14222397
Alignment:
| Q |
207 |
aattgattctgcagtaattttcttaggaatctcttttattgttgtatt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14222444 |
aattgattctgcagtaattttcttaggaatctcttttattgttgtatt |
14222397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University