View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0404_low_5 (Length: 274)
Name: NF0404_low_5
Description: NF0404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0404_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 126 - 247
Target Start/End: Complemental strand, 49009121 - 49009000
Alignment:
Q |
126 |
aatatcaagtaatgatctggtcatgaattgagaaaaatgaaatcaaggattggtagaagcataatatcctcatcttaacctaagcaatcattaatattca |
225 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49009121 |
aatatcaagtaatgatctggtcatgaattgagaaaaatgaaatcaaggattggtagaagcataatatcctcatcttaacctaagcaatcattaatattca |
49009022 |
T |
 |
Q |
226 |
aggaaacactttaagctctatg |
247 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
49009021 |
aggaaacactttaagctctatg |
49009000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University