View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0404_low_7 (Length: 250)
Name: NF0404_low_7
Description: NF0404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0404_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 13211029 - 13210790
Alignment:
| Q |
1 |
cacttttactcgacaattttatcatcttcttcttcttcttatcaccattgttattatctacgttccagaatttggaatagtttaaatgcttccctctaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13211029 |
cacttttactcgacaattttatcatcttcttcttcttcttatcaccattgttattttctacgttccagaatttggaatagtttaaatgcttccctctaac |
13210930 |
T |
|
| Q |
101 |
ttcattgatacctgcgtttgcaagtgagacacatgttatgacggacatggtggtgatgaatagtgatggtgggggtgggaataggaagtttaggaacgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13210929 |
ttcattgatacctgcgtttgcaagggagacacatgttatgacagacatggtggtgatgaatagtgaaggtgggggtgggaataggaagtttaggaacgtg |
13210830 |
T |
|
| Q |
201 |
gagaatgtcatggtttgtttgttttgtgtggttttctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13210829 |
gagaatgtcatggtttgtttgttttgtgtggttttctgtg |
13210790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 104
Target Start/End: Complemental strand, 13184860 - 13184804
Alignment:
| Q |
48 |
ttgttattatctacgttccagaatttggaatagtttaaatgcttccctctaatttca |
104 |
Q |
| |
|
|||||||||| | | ||||| ||||||||||| || |||||||| |||||||||||| |
|
|
| T |
13184860 |
ttgttattatttgcattccaaaatttggaataattcaaatgctttcctctaatttca |
13184804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 705 times since January 2019
Visitors: 3064