View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0405_low_2 (Length: 329)
Name: NF0405_low_2
Description: NF0405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0405_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 89 - 214
Target Start/End: Original strand, 46891906 - 46892030
Alignment:
Q |
89 |
acttctcccccaaacccaaaaaagaggttaatggaaaaccccattggcagaatccttgaacattggctagtctaccatccaaacattctaaatttcacat |
188 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46891906 |
acttctcccccaaacccaaaaa-gaggtgaatggaaaaccccattggcagaatccttgaacattggctagtctaccatccaaacattctaaatttcacat |
46892004 |
T |
 |
Q |
189 |
ggaaccctcctcacactccagcctca |
214 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
46892005 |
ggaaccctcctcacactccagcctca |
46892030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 585 times since January 2019
Visitors: 3061