View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0405_low_4 (Length: 293)
Name: NF0405_low_4
Description: NF0405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0405_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 108 - 265
Target Start/End: Original strand, 48584483 - 48584640
Alignment:
Q |
108 |
attacatgttctagatgttaacattattaattaatgatgcatgtttcttaatgtcttccataaactcatcaagattccgatcagaggatccaccaacggc |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48584483 |
attacatgttctagatgttaacattattaattaatgatgcatgtttcttaatgtcttccataaactcatcaagattccgatcagaggatccaccaacggc |
48584582 |
T |
 |
Q |
208 |
caaagcttcctccgccttcttcttccacttttttgcattttgcttcaacttctctgct |
265 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
48584583 |
caaagcttcctccgccttcttcttccacttgtttgcattttgcttcaacttctctgct |
48584640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 152 - 265
Target Start/End: Complemental strand, 48619150 - 48619037
Alignment:
Q |
152 |
ttcttaatgtcttccataaactcatcaagattccgatcagaggatccaccaacggccaaagcttcctccgccttcttcttccacttttttgcattttgct |
251 |
Q |
|
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||| ||||||||| || |
|
|
T |
48619150 |
ttctgaatgtcttccataaattcatcaagattccgatcagaggatccaccaatggccactgcttcatccgccttcttcttccacttcattgcatttttct |
48619051 |
T |
 |
Q |
252 |
tcaacttctctgct |
265 |
Q |
|
|
|||||| ||||||| |
|
|
T |
48619050 |
tcaactcctctgct |
48619037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 151 - 255
Target Start/End: Original strand, 11546415 - 11546519
Alignment:
Q |
151 |
tttcttaatgtcttccataaactcatcaagattccgatcagaggatccaccaacggccaaagcttcctccgccttcttcttccacttttttgcattttgc |
250 |
Q |
|
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||| |||||||| ||||| |||||||||||| ||||||||| | |
|
|
T |
11546415 |
tttcttaatgtcttccaaaaattcatcaagattccgatcagaggatccaccaatggccactgcttcctcagcctttttcttccactttattgcatttttc |
11546514 |
T |
 |
Q |
251 |
ttcaa |
255 |
Q |
|
|
||||| |
|
|
T |
11546515 |
ttcaa |
11546519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 150 - 265
Target Start/End: Original strand, 48628108 - 48628223
Alignment:
Q |
150 |
gtttcttaatgtcttccataaactcatcaagattccgatcagaggatccaccaacggccaaagcttcctccgccttcttcttccacttttttgcattttg |
249 |
Q |
|
|
|||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |||||||| |||| |||||||||||| ||||||||| |
|
|
T |
48628108 |
gttttttaatgtcttccataaatgcatcaagattccaatcagaggatccaccaacggccactgcttcctctgcctccttcttccacttcattgcattttt |
48628207 |
T |
 |
Q |
250 |
cttcaacttctctgct |
265 |
Q |
|
|
|||||||| ||||||| |
|
|
T |
48628208 |
cttcaactcctctgct |
48628223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 149 - 265
Target Start/End: Original strand, 48666350 - 48666466
Alignment:
Q |
149 |
tgtttcttaatgtcttccataaactcatcaagattccgatcagaggatccaccaacggccaaagcttcctccgccttcttcttccacttttttgcatttt |
248 |
Q |
|
|
||||||||||||||||||||||| ||||||||| || || ||||| |||||||| |||| |||||||||||| ||| ||| |||| ||||||||| |
|
|
T |
48666350 |
tgtttcttaatgtcttccataaatgcatcaagatgtcggtccgaggaaccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttt |
48666449 |
T |
 |
Q |
249 |
gcttcaacttctctgct |
265 |
Q |
|
|
||||||| |||||||| |
|
|
T |
48666450 |
tcttcaacgtctctgct |
48666466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 161 - 265
Target Start/End: Original strand, 48655786 - 48655890
Alignment:
Q |
161 |
tcttccataaactcatcaagattccgatcagaggatccaccaacggccaaagcttcctccgccttcttcttccacttttttgcattttgcttcaacttct |
260 |
Q |
|
|
||||| ||||| ||||||||| || || ||||||||||| ||||| | || |||||||| |||||||||||| ||||||||| |||||||| || |
|
|
T |
48655786 |
tcttcgataaatgcatcaagatatcggtcggaggatccacctacggcaactgcatcctccgctgccttcttccacttgattgcatttttcttcaactcct |
48655885 |
T |
 |
Q |
261 |
ctgct |
265 |
Q |
|
|
||||| |
|
|
T |
48655886 |
ctgct |
48655890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 152 - 262
Target Start/End: Complemental strand, 19666506 - 19666396
Alignment:
Q |
152 |
ttcttaatgtcttccataaactcatcaagattccgatcagaggatccaccaacggccaaagcttcctccgccttcttcttccacttttttgcattttgct |
251 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||| |||| |||||||||||| ||||||||||| |||||||||||| |
|
|
T |
19666506 |
ttcttaatgtcttccataaattcatcaagattccgatcagaggaaccaccggtcgccaccgcttcctccgccgctttcttccacttgattgcattttgct |
19666407 |
T |
 |
Q |
252 |
tcaacttctct |
262 |
Q |
|
|
|||||| |||| |
|
|
T |
19666406 |
tcaactcctct |
19666396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 153 - 265
Target Start/End: Original strand, 27227341 - 27227453
Alignment:
Q |
153 |
tcttaatgtcttccataaactcatcaagattccgatcagaggatccaccaacggccaaagcttcctccgccttcttcttccacttttttgcattttgctt |
252 |
Q |
|
|
||||||||||||||||||| |||||| || |||||||||||| ||||| || || | || ||||||| |||||||||||| ||| |||||||| |
|
|
T |
27227341 |
tcttaatgtcttccataaatgcatcaatatgccgatcagaggaaccacctaccgcaactgcagcctccgctgccttcttccacttgattgtgttttgctt |
27227440 |
T |
 |
Q |
253 |
caacttctctgct |
265 |
Q |
|
|
|||| |||||||| |
|
|
T |
27227441 |
caacatctctgct |
27227453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 441 times since January 2019
Visitors: 3060