View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0407_high_3 (Length: 267)
Name: NF0407_high_3
Description: NF0407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0407_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 46 - 239
Target Start/End: Original strand, 40414936 - 40415128
Alignment:
Q |
46 |
catttcccatacactactatgaaggtaatttctgaaaatcctataatgttcataaagtccaccttcaaccgtaactacgctttttctattattgatacaa |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| | |||||||||||||||||||||| |
|
|
T |
40414936 |
catttcccatacactactatgaaggtaatttctgaaaatcctataatgttcataaagttcaatttcaaccgtaaccatgctttttctattattgatacaa |
40415035 |
T |
 |
Q |
146 |
ttccagctccgactaggcgagcaccgcgctctgttactatgtcgcagacctcgacaaccacttcgcgtgccattggagttgtgctagtgatctg |
239 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40415036 |
ttccagc-ccgactaggcgagcaccgcgctctgttactatgttgcagacctcgacaaccacttcgcgtgccattggagttgtgctagtgatctg |
40415128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 931 times since January 2019
Visitors: 3072