View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0407_high_5 (Length: 251)
Name: NF0407_high_5
Description: NF0407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0407_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 39972905 - 39972663
Alignment:
| Q |
1 |
aggcataacagtttggtttggtttatgagaaaataaatctgaaccaatttgttcagcatttggaaaattaatcgcgaattcgattaatagcttttaacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39972905 |
aggcataacagtttggtttggtttatgagaaaataaatccgaaccaatttgttcagcatttggaaaattaatcgcgaattcgattaatagcttttaacaa |
39972806 |
T |
|
| Q |
101 |
tgattctttttatttctaacatgtcaaagaaaaaactgtatcatttggtttaggaaatagccaaatattgttaacgagactatgaattttaagaactagt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39972805 |
tgattctttttatttcaaacatgtcaaagaaaaaactgtatgatttggtttaggaaatagccaaatattgttaacgagactatgaattttaagaac---t |
39972709 |
T |
|
| Q |
201 |
acaagctgaattttggaaatagccaatcctttcgtttcatctcact |
246 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
39972708 |
acaagctgaattctggaaatagccaatcctttcgtttcatttcact |
39972663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 694 times since January 2019
Visitors: 3064