View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0407_low_11 (Length: 202)
Name: NF0407_low_11
Description: NF0407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0407_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 28998691 - 28998560
Alignment:
| Q |
10 |
gcacagatcactaagaaatggaaaccctatactcactttataaactagaggtccaattaatgaagaagaggatgaaggaaattaaaatagacaaatccaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28998691 |
gcacagatcactaagaaatggaaaccctatactcattttataaactagaggtccaattaatgaaga---ggatgaaggaaattaaaatagacaaatccaa |
28998595 |
T |
 |
| Q |
110 |
catcatacaatagtaccatagttgaccacaattac |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28998594 |
catcatacaatagtaccatagttgaccacaattac |
28998560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University