View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0407_low_4 (Length: 299)
Name: NF0407_low_4
Description: NF0407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0407_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 74 - 242
Target Start/End: Complemental strand, 33612443 - 33612275
Alignment:
| Q |
74 |
aggatctttataaacaatccaattcaagttgatttaaattgcaataagggatctgaaaagcaaaaaatggaacgatccacagtttgttcactcatgttca |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33612443 |
aggatctttataaacaatccaattcaagttgatttaaattgcaataagggatctgaaaagcaaaaaatggaacgatccacagtttgttcactcatgttca |
33612344 |
T |
|
| Q |
174 |
atctatggaaaccatttttatgtgtgattgtttcatatggttgctgcttctttttaggttgttcatctc |
242 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33612343 |
atccatggaaaccatttttatgtgtgattgtttcatatggttgctgcttgtttttaggttgttcatctc |
33612275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 578 times since January 2019
Visitors: 3061