View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0408_high_5 (Length: 257)

Name: NF0408_high_5
Description: NF0408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0408_high_5
NF0408_high_5
[»] chr5 (1 HSPs)
chr5 (182-257)||(17625372-17625447)


Alignment Details
Target: chr5 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 182 - 257
Target Start/End: Complemental strand, 17625447 - 17625372
Alignment:
182 ttttcttatttcagtgaccaaaatttgaagtaatttatttttcttataatagttactagcgtatttttgttgattt 257  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
17625447 ttttcttatttcagtgaccaaaatttgaagtaatttatttttcttatattagttactagcgtatttttgttgattt 17625372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University