View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0408_high_5 (Length: 257)
Name: NF0408_high_5
Description: NF0408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0408_high_5 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 182 - 257
Target Start/End: Complemental strand, 17625447 - 17625372
Alignment:
Q |
182 |
ttttcttatttcagtgaccaaaatttgaagtaatttatttttcttataatagttactagcgtatttttgttgattt |
257 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
17625447 |
ttttcttatttcagtgaccaaaatttgaagtaatttatttttcttatattagttactagcgtatttttgttgattt |
17625372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 601 times since January 2019
Visitors: 3061