View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0408_high_7 (Length: 221)

Name: NF0408_high_7
Description: NF0408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0408_high_7
NF0408_high_7
[»] chr3 (2 HSPs)
chr3 (50-215)||(42604100-42604265)
chr3 (58-197)||(49043677-49043818)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 50 - 215
Target Start/End: Complemental strand, 42604265 - 42604100
Alignment:
50 atctgtttctcttctttctcttagtttttaaaatataaatagaaatggcattatgaaaggatagatggcaaggttggtggggctgaaaggcaaatacgga 149  Q
    |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||    
42604265 atctatttctcttctttctcttagtttttaaaatataaatagaaatgccattatgaaaggatagatggcaaggttggtggggctgaaagacaaatacgga 42604166  T
150 tagatcgtttttaatgccaaaaattcaagattttgctttcttctttctgcaacagctagggctttg 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||| ||||    
42604165 tagatcgtttttaatgccaaaaattcaagattttgctttcttctttcttcaagagctgggggtttg 42604100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 58 - 197
Target Start/End: Original strand, 49043677 - 49043818
Alignment:
58 ctcttctttctcttagtttttaaaatataaatagaaatggcattatgaaaggatagatggcaaggttggtggggctgaaaggcaaatacggatagatcgt 157  Q
    |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||     
49043677 ctcttctttctcttggcttttaaaatataaatagaaatggcattatgaaaggatagatggcaaggttggtggggctgaaagacaaatacggatagatcg- 49043775  T
158 ttttaatgccaaaaa---ttcaagattttgctttcttctttct 197  Q
    |||||||||||||||   |||||||||||||||||||||||||    
49043776 ttttaatgccaaaaattcttcaagattttgctttcttctttct 49043818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University