View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0408_low_11 (Length: 221)
Name: NF0408_low_11
Description: NF0408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0408_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 50 - 215
Target Start/End: Complemental strand, 42604265 - 42604100
Alignment:
Q |
50 |
atctgtttctcttctttctcttagtttttaaaatataaatagaaatggcattatgaaaggatagatggcaaggttggtggggctgaaaggcaaatacgga |
149 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
42604265 |
atctatttctcttctttctcttagtttttaaaatataaatagaaatgccattatgaaaggatagatggcaaggttggtggggctgaaagacaaatacgga |
42604166 |
T |
 |
Q |
150 |
tagatcgtttttaatgccaaaaattcaagattttgctttcttctttctgcaacagctagggctttg |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||| |||| |
|
|
T |
42604165 |
tagatcgtttttaatgccaaaaattcaagattttgctttcttctttcttcaagagctgggggtttg |
42604100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 58 - 197
Target Start/End: Original strand, 49043677 - 49043818
Alignment:
Q |
58 |
ctcttctttctcttagtttttaaaatataaatagaaatggcattatgaaaggatagatggcaaggttggtggggctgaaaggcaaatacggatagatcgt |
157 |
Q |
|
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
49043677 |
ctcttctttctcttggcttttaaaatataaatagaaatggcattatgaaaggatagatggcaaggttggtggggctgaaagacaaatacggatagatcg- |
49043775 |
T |
 |
Q |
158 |
ttttaatgccaaaaa---ttcaagattttgctttcttctttct |
197 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
49043776 |
ttttaatgccaaaaattcttcaagattttgctttcttctttct |
49043818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1309 times since January 2019
Visitors: 3079