View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0408_low_6 (Length: 313)
Name: NF0408_low_6
Description: NF0408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0408_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 30 - 302
Target Start/End: Complemental strand, 52315939 - 52315667
Alignment:
Q |
30 |
tccttttcctttgtgcatgttgttgattcctcttgttgttcatctttctttgttgagtttactgtatcctcttcctcttttagttccttagtttccgtaa |
129 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52315939 |
tccttttcctttgtgcatgttgttgagtcctcttgttgttcatctttctttgttgagtttactgtatcctcttcctcttttagttccttagtttccgtaa |
52315840 |
T |
 |
Q |
130 |
caacaacaaccttacgaggccttcctctcttccgacgaggagcttcttctggttcacctccttctgttgatgcagcagcatcctcagctagcgctactga |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52315839 |
caacaacaaccttacgaggccttcctctcttccgacgaggagcttcttctggttcacctccttctgttgatgcagcagcatcctcagctagcgctactga |
52315740 |
T |
 |
Q |
230 |
tgaaagttcctttgttttctgtcgctttttccccataaataaatacttctattattttctacatcagctctct |
302 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52315739 |
tgaaagttcctttgttttctgtcgctttttccccataaataaatacttctattattttctacatcagctctct |
52315667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University