View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0409_high_7 (Length: 312)
Name: NF0409_high_7
Description: NF0409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0409_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 17 - 167
Target Start/End: Original strand, 33367964 - 33368114
Alignment:
| Q |
17 |
cagagaagggactcttgggtgagaccaaagataaggaagttggggtttggtgtaaggtgaagagtggttgttatggcgttgatttctgaaaaggacatgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33367964 |
cagagaagggactcttgggtgagaccaaagataaggaagttggggtttggtgtaaggtgaagagtggttgttatggcgttgatttctgaaaaggacatgg |
33368063 |
T |
 |
| Q |
117 |
atttggtggtggagttcgaggaggaggcgtagtgaaccagagctttagtta |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33368064 |
atttggtggtggagttcgaggaggaggcgtagtgaacgagagctttagtta |
33368114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 17 - 150
Target Start/End: Original strand, 33372165 - 33372298
Alignment:
| Q |
17 |
cagagaagggactcttgggtgagaccaaagataaggaagttggggtttggtgtaaggtgaagagtggttgttatggcgttgatttctgaaaaggacatgg |
116 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33372165 |
cagagaagtgactcatgggtgagaccaaagatgaggaagttggggtgtggtgtaaggtgaagagtggttgttatagcgttgatttcttcaaaggacatgg |
33372264 |
T |
 |
| Q |
117 |
atttggtggtggagttcgaggaggaggcgtagtg |
150 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||| |
|
|
| T |
33372265 |
atttggtggtggtgtttaaggaggaggcatagtg |
33372298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University