View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0409_low_14 (Length: 223)
Name: NF0409_low_14
Description: NF0409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0409_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 24521132 - 24521012
Alignment:
Q |
1 |
ttcatctttgatattgtcccttgcattcataagtctagataccaactcattaaacttactaatatgatcaaacaaattaccttcatattccagctttaac |
100 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
T |
24521132 |
ttcacctttgatattgtcccttgcattcataagtctagataccaactcattaaacttactaatatgatcaaacacattaccttcatcttccagctttaac |
24521033 |
T |
 |
Q |
101 |
gagtacaagctcattttcatc |
121 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
24521032 |
gagtacaagctcattttcatc |
24521012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University