View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0409_low_15 (Length: 204)
Name: NF0409_low_15
Description: NF0409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0409_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 36941447 - 36941335
Alignment:
| Q |
1 |
atcaagtgcatgatgattgttggtctttggtgtgctcatcctgatcctaataataggccttcaataagacaagctattcaagtgcttaattttgaagttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36941447 |
atcaagtgcatgatgattgttggtctttggtgtgctcatcctgatcctaataataggccttcaataagacaagctattcaagtgcttaattttgaagttc |
36941348 |
T |
 |
| Q |
101 |
cattgcctaatct |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36941347 |
cattgcctaatct |
36941335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 36939677 - 36939789
Alignment:
| Q |
1 |
atcaagtgcatgatgattgttggtctttggtgtgctcatcctgatcctaataataggccttcaataagacaagctattcaagtgcttaattttgaagttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36939677 |
atcaagtgcatgatgattgttggtctttggtgtgctcatcctgatcctaataataggccttcaataagacaagctattcaagtgcttaattttgaagttc |
36939776 |
T |
 |
| Q |
101 |
cattgcctaatct |
113 |
Q |
| |
|
|| | |||||||| |
|
|
| T |
36939777 |
cacttcctaatct |
36939789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 113
Target Start/End: Complemental strand, 28294072 - 28293964
Alignment:
| Q |
5 |
agtgcatgatgattgttggtctttggtgtgctcatcctgatcctaataataggccttcaataagacaagctattcaagtgcttaattttgaagttccatt |
104 |
Q |
| |
|
||||| ||||||||||||| | |||||||||||||||||| || | ||| || || || |||||||| |||||||||||||||||||| ||| | || |
|
|
| T |
28294072 |
agtgcttgatgattgttggattgtggtgtgctcatcctgatgttagtcttagaccatcgattagacaagcaattcaagtgcttaattttgaggttgcctt |
28293973 |
T |
 |
| Q |
105 |
gcctaatct |
113 |
Q |
| |
|
||| ||||| |
|
|
| T |
28293972 |
gccaaatct |
28293964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University