View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0409_low_8 (Length: 351)
Name: NF0409_low_8
Description: NF0409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0409_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 5 - 255
Target Start/End: Complemental strand, 7028539 - 7028289
Alignment:
| Q |
5 |
gaggagcagagatagaagtagaaggagaaaatatcttgtttgaaattggatttggaactacacccctcggttttaaaataagcaagagagtgagataaag |
104 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7028539 |
gaggtgcagggatagaagtagaaggagaaaatatcttgtttgaaattggatttggaactacacccctcggttttaaaataagcaagagagtgagataaag |
7028440 |
T |
|
| Q |
105 |
aaacaaacttatgctactactggattcacaaattttcattttggagggagtctcaagatatctgcaaaatgaaaacaaaagtaggaagaaaaaggcaacg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7028439 |
aaacaaacttatgctactactggattcacaaattttcattttggagggagcctcaagatatctgcaaaatgaaaagaatagtaggaagaaaaaggcaacg |
7028340 |
T |
|
| Q |
205 |
aagtttactacttgatattggactgtatattataattgcctaatgagtaat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7028339 |
aagtttactacttgatattggactgtatattataattgcctaatgagtaat |
7028289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 62 - 150
Target Start/End: Complemental strand, 7020834 - 7020746
Alignment:
| Q |
62 |
ctacacccctcggttttaaaataagcaagagagtgagataaagaaacaaacttatgctactactggattcacaaattttcattttggag |
150 |
Q |
| |
|
|||| |||||||||| | |||||| ||| | |||||| ||| || ||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7020834 |
ctacccccctcggttctgaaataaccaaaaatgtgagaaaaactaataaacttatgctactactagattcacaatttttcattttggag |
7020746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 253 - 289
Target Start/End: Complemental strand, 7028274 - 7028238
Alignment:
| Q |
253 |
aatattacaggtatgttgctatcttgtgaccataatg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7028274 |
aatattacaggtatgttgctatcttgtgaccataatg |
7028238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 129
Target Start/End: Complemental strand, 7035200 - 7035159
Alignment:
| Q |
88 |
aagagagtgagataaagaaacaaacttatgctactactggat |
129 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
7035200 |
aagagagtgagataaacaaataaacttatgctactacaggat |
7035159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 5 - 38
Target Start/End: Original strand, 7078689 - 7078722
Alignment:
| Q |
5 |
gaggagcagagatagaagtagaaggagaaaatat |
38 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
7078689 |
gaggagcagggatagaagtagaaggagaaaatat |
7078722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 306 times since January 2019
Visitors: 3059