View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0409_low_9 (Length: 337)
Name: NF0409_low_9
Description: NF0409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0409_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 200
Target Start/End: Complemental strand, 4576463 - 4576268
Alignment:
| Q |
7 |
ggaagtgctgaaagacccaaaggtcaatgctataatctttatttaatttttctactct--atttatatttctttgcgttcaagtcatgaagtagaaaatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4576463 |
ggaagtgctgaaagacccaaaggtcaatgctataatctttatttaatttttctactctctatttatatttctttgcgttcaagtcatgaagtagaaaatt |
4576364 |
T |
|
| Q |
105 |
cattcccttcttctggtatgtttttctactctctctgtctttttgattaatactcatgttgctcttgttcttatcttacacctaataaaataatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4576363 |
cattcccttcttctggtatgtttttctactctctctgtctttttgattaatactcatgttgctcttgttcttatcttacacctaataaaataatgg |
4576268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1200 times since January 2019
Visitors: 3078