View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0410_high_11 (Length: 286)

Name: NF0410_high_11
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0410_high_11
NF0410_high_11
[»] chr4 (1 HSPs)
chr4 (66-210)||(22361677-22361827)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 66 - 210
Target Start/End: Complemental strand, 22361827 - 22361677
Alignment:
66 gtcgatgctcaacgcgaagctgtaatacttccttcaacatgggctgctcctggaggtgg------agggaaaaaggaggaagatgttcaaacaaagggtg 159  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||      |||||||||||| ||||||||||||||||||||||    
22361827 gtcgatgctcaacgtgaagctgtaatacttccttcaacatgggctgctcctggtggtggtggtggagggaaaaaggatgaagatgttcaaacaaagggtg 22361728  T
160 ttaaagggtttgttaatgatgtgattatggatgtttttgaataggttgttt 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
22361727 ttaaagggtttgttaatgatgtgattatggatgtttttgaataggttgttt 22361677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 643 times since January 2019
Visitors: 3063