View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_high_11 (Length: 286)
Name: NF0410_high_11
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 66 - 210
Target Start/End: Complemental strand, 22361827 - 22361677
Alignment:
| Q |
66 |
gtcgatgctcaacgcgaagctgtaatacttccttcaacatgggctgctcctggaggtgg------agggaaaaaggaggaagatgttcaaacaaagggtg |
159 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
22361827 |
gtcgatgctcaacgtgaagctgtaatacttccttcaacatgggctgctcctggtggtggtggtggagggaaaaaggatgaagatgttcaaacaaagggtg |
22361728 |
T |
 |
| Q |
160 |
ttaaagggtttgttaatgatgtgattatggatgtttttgaataggttgttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22361727 |
ttaaagggtttgttaatgatgtgattatggatgtttttgaataggttgttt |
22361677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University