View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_high_16 (Length: 263)
Name: NF0410_high_16
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 24 - 232
Target Start/End: Original strand, 11711973 - 11712181
Alignment:
| Q |
24 |
atgaatactggtgatggtgaaggcaaatcatccggactgcgagcttatgtgacgcagttggatacggaggcacttcagagacttgctaccgtacgctcca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11711973 |
atgaatactggtgatggtgaaggcaaatcatccggactgcgagcttatgtgacgcagttggatacggaggcacttcagagacttgctaccgtacgctcca |
11712072 |
T |
|
| Q |
124 |
aggaagctatatcactgattgaaaagcaaactcaggccctctttggaaggcctgatatccgcctctctggcgatggttcgattgaaactaccaatgatga |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11712073 |
aggaagctatatcattgattgaaaagcaaactcaggccctctttggaaggcctgatatccgcctctctggcgatggttcgattgaaactaccaatgatga |
11712172 |
T |
|
| Q |
224 |
agttctttc |
232 |
Q |
| |
|
||||||||| |
|
|
| T |
11712173 |
agttctttc |
11712181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 677 times since January 2019
Visitors: 3063