View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_high_17 (Length: 263)
Name: NF0410_high_17
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_high_17 |
 | |
|
| [»] scaffold0699 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0699 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: scaffold0699
Description:
Target: scaffold0699; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 1764 - 1536
Alignment:
| Q |
13 |
gagagtgttggctgaatcctgcgtttgtgttgccgtgaagatggtgaagggacgtcaaggagagcgtgtcaggtattcttcgtttcatcttatacctgta |
112 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1764 |
gagagtgttggcagaatcctgcgtttgtgttgccgtgaagatggtgaagggacgtcaaggagagcgtgtcaggtactcttcgtttcatcttatacctgta |
1665 |
T |
|
| Q |
113 |
gttttgatccctttcttttctgcaattgattttgtttgtattttcatcatcatcattatcgtatatgtgtttgatgttttgtaattatcaatttattcgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1664 |
gttttgatccctttcttttctgcaattgattttgtttgtattttcatcatcatcattatcgtatatgtgtttgatgttttgtaattatcaatttattcag |
1565 |
T |
|
| Q |
213 |
ctatatctactgttaagtaatttgatgatg |
242 |
Q |
| |
|
||||| |||||||| ||||||||||||||| |
|
|
| T |
1564 |
ctatagctactgtt-agtaatttgatgatg |
1536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0699; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 99
Target Start/End: Complemental strand, 7413 - 7361
Alignment:
| Q |
47 |
gtgaagatggtgaagggacgtcaaggagagcgtgtcaggtattcttcgtttca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| || |||||||| |
|
|
| T |
7413 |
gtgaagatggtgaagggacgtcaaggagagcgagtcaggtactcctcgtttca |
7361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 99
Target Start/End: Original strand, 43601434 - 43601486
Alignment:
| Q |
47 |
gtgaagatggtgaagggacgtcaaggagagcgtgtcaggtattcttcgtttca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| || |||||||| |
|
|
| T |
43601434 |
gtgaagatggtgaagggacgtcaaggagagcgagtcaggtactcctcgtttca |
43601486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 537 times since January 2019
Visitors: 3060