View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_high_19 (Length: 260)
Name: NF0410_high_19
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_high_19 |
 |  |
|
| [»] scaffold0175 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0175 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: scaffold0175
Description:
Target: scaffold0175; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 254
Target Start/End: Original strand, 32818 - 33048
Alignment:
| Q |
21 |
acatcatcaccaaccaactctcctccacctattaactggtatggcatcacttatgagagaagggttgaaccacatgcttcagttcctgttccaagtgttt |
120 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
32818 |
acatcatctccaaccaactctcctccacctattaactggtatggcatcacttatgagagaagggttgaaccacatgcttcaattcctattccaagtgttt |
32917 |
T |
 |
| Q |
121 |
cgt-ccctactccggatcgatctgcgtctccatctccatctcctgatatgaacattcccatccgtaaatgtaaccgttcaacctgtaatccttaccctat |
219 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32918 |
cgtcccctactccggaatgatctgcgtctccatctccatctcctgatatgaccattcccatccgtaaatgtaaccgttcaacccgtaatccttaccctat |
33017 |
T |
 |
| Q |
220 |
ttataattaatttcttgtcatatcatcatttatct |
254 |
Q |
| |
|
||| |||||||||||||||||||| ||||||| |
|
|
| T |
33018 |
tta----taatttcttgtcatatcatcgtttatct |
33048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University