View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_low_14 (Length: 320)
Name: NF0410_low_14
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_low_14 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 90 - 320
Target Start/End: Complemental strand, 17597728 - 17597498
Alignment:
| Q |
90 |
ttttgaacctcttgtgagtagattcaaacatgaatcttgccacatcaatcacaatcacctacaaacattgatctcagactgcctttcggaacattgactc |
189 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17597728 |
ttttgaacctctagttagtagattcaaacatgaatcttgcaacatcaatcacaatcacctacaaacattgatctcagactgcctttcggaacattgactc |
17597629 |
T |
 |
| Q |
190 |
aatatcaccattgcttgaatttgctttgttagaaggaccagtcttgaaatctactcctccaaatccatattgttgcacaacaagtattgatgaatttgaa |
289 |
Q |
| |
|
|| ||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17597628 |
aagatcaccattgcttgaattttctttgttagaaggatcagtcttgaaatctactcctccaaatccatattgttgcacaacaagtattgatgaatttgaa |
17597529 |
T |
 |
| Q |
290 |
ccaaaactatttgatgctaacatgtcaccaa |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17597528 |
ccaaaactatttgatgctaacatgtcaccaa |
17597498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University