View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_low_15 (Length: 318)
Name: NF0410_low_15
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 84 - 228
Target Start/End: Original strand, 44444750 - 44444894
Alignment:
| Q |
84 |
ctagctgttgcgctagaaactagaaattctgcaaacctggcactcttgcaagcgtgcaggacagtgcaatccaaaatatgtaattataaataacttttac |
183 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44444750 |
ctagctattgcgctagaaactagaaattctgcaaacctggcactcttgcaagcgtgcgggacagtgcaatccaaaatatgtaattataaataacttttac |
44444849 |
T |
 |
| Q |
184 |
acggcattcatgtgaagaacgaagcagattaaaatttcttgatga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44444850 |
acggcattcatgtgaagaacgaagcagattaaaatttcttgatga |
44444894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University