View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0410_low_15 (Length: 318)

Name: NF0410_low_15
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0410_low_15
NF0410_low_15
[»] chr7 (1 HSPs)
chr7 (84-228)||(44444750-44444894)


Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 84 - 228
Target Start/End: Original strand, 44444750 - 44444894
Alignment:
84 ctagctgttgcgctagaaactagaaattctgcaaacctggcactcttgcaagcgtgcaggacagtgcaatccaaaatatgtaattataaataacttttac 183  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
44444750 ctagctattgcgctagaaactagaaattctgcaaacctggcactcttgcaagcgtgcgggacagtgcaatccaaaatatgtaattataaataacttttac 44444849  T
184 acggcattcatgtgaagaacgaagcagattaaaatttcttgatga 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
44444850 acggcattcatgtgaagaacgaagcagattaaaatttcttgatga 44444894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University