View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_low_17 (Length: 309)
Name: NF0410_low_17
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 2508458 - 2508218
Alignment:
| Q |
11 |
cacagaggaaaacaagtccaaggtagtggtgattgattctttgcaatcgtgggagtttcatgtcaaccaagcttctaatcagaattctcctgtaagtcaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2508458 |
cacagaggaaaacaagtccaaggtagtggtgattgattctttgcaatcatgggagtttcatgtcaaccaagcttctaatcagaattctcctgtaagtcaa |
2508359 |
T |
 |
| Q |
111 |
agtttgaatgtttttgaagcttcaaacgagtatttgatttgtgaattttctagttttgattcaaattgatttgctggttcaggttgtgttgttctttttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2508358 |
agtttgaatgtttttgaagcttcaaacgagtatttgatttgtgaattttctagttttgattcaaattgatttgctggttcaggttgtgttgttctttttc |
2508259 |
T |
 |
| Q |
211 |
tttaaggattgagtattattggattgattgatagatatatt |
251 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
2508258 |
tttaagggtagagtattattggattgattgatagatatatt |
2508218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University