View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_low_21 (Length: 293)
Name: NF0410_low_21
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 106 - 286
Target Start/End: Original strand, 16662656 - 16662838
Alignment:
| Q |
106 |
ttcctgccattcatattattagatgggaccaccattttcatccctgagnnnnnnnnnnat-gggaccaatattattttcacattgattaatcagttt-at |
203 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16662656 |
ttcctgccattcatattattagatggaaccaccattttcatccttgagttttttttttttagggaccaatattattttcacattgattaatcagtttcat |
16662755 |
T |
|
| Q |
204 |
cgaaggaacatgttctaagaagagaggagaaagatattaggttaaaaacctttttattttaatctacttgtcagttcatctca |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16662756 |
cgaaggaacatgttctaagaagagaggagaaagatattaggttaaaaacttttttattttaatctacttgtcagttcatctca |
16662838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 576 times since January 2019
Visitors: 3061