View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_low_35 (Length: 259)
Name: NF0410_low_35
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0410_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 30 - 258
Target Start/End: Complemental strand, 10202102 - 10201874
Alignment:
Q |
30 |
acaacgacattaaaatctctttttccttagattgtactccacttttatcaatttgttcattttctaatttagacgacaacaaaaatctaatgattgtcaa |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10202102 |
acaacgacattaaaatctctttttccttagattgtactccacttttatcaatttgttcattttctaatttagacgacaacaaaaatctaatgattgtcaa |
10202003 |
T |
 |
Q |
130 |
gttaattcgaggacattttgaaatgcgtaggctccaagcaacagcctcgcggtcatccggccctccnnnnnnnngtgttgcaacattttgaatggtttca |
229 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
10202002 |
gttaattcgagggcattttgaaatgcgtaggctccaagcaacagcctcgcggtcatccggccctccaaaaaaaagtgttgcaacattttgaatggtttca |
10201903 |
T |
 |
Q |
230 |
gattctattagttccgagaaaccaaatga |
258 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
10201902 |
gattctattagttccgagaaaccaaatga |
10201874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 195
Target Start/End: Complemental strand, 51741230 - 51741139
Alignment:
Q |
104 |
gacaacaaaaatctaatgattgtcaagttaattcgaggacattttgaaatgcgtaggctccaagcaacagcctcgcggtcatccggccctcc |
195 |
Q |
|
|
||||| |||||||| |||||||||| ||||| ||||| ||||||||||| | |||||||||||| | |||||| || || ||||| ||||| |
|
|
T |
51741230 |
gacaaaaaaaatctgatgattgtcagattaatgcgagggcattttgaaattcttaggctccaagctatagcctcacgatcgtccgggcctcc |
51741139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University