View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_low_38 (Length: 250)
Name: NF0410_low_38
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_low_38 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 30 - 250
Target Start/End: Original strand, 49513985 - 49514205
Alignment:
| Q |
30 |
tatgtctcacgtgtaattcagattattaattttcttccacagcatagattttttatccgtaacgatgataagtatactcgtatccgcaatgtatatctta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49513985 |
tatgtctcacgtgtaattcagattattaattttcttccacagcatagattttttatccgtaacgatgataagtatactcgtatccgcaatgtatatctta |
49514084 |
T |
 |
| Q |
130 |
gaataataactttttctgcattcctggttcaatattgtattatttatgtttactatgccatatgtgcacctctcttttttcctcttttataatcctgcaa |
229 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49514085 |
gaattataactttttctgcattcctggttcaatattgtattatttatgtttactatgccatatgtgcacctctcttttttcctcttttataatcctgcaa |
49514184 |
T |
 |
| Q |
230 |
cttagttccttatctgcctct |
250 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49514185 |
cttagttccttatctgcctct |
49514205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 211
Target Start/End: Original strand, 27745690 - 27745758
Alignment:
| Q |
143 |
ttctgcattcctggttcaatattgtattatttatgtttactatgccatatgtgcacctctcttttttcc |
211 |
Q |
| |
|
|||||||||||||||||| |||| | || |||||||||| || | |||||||| ||||||||||||| |
|
|
| T |
27745690 |
ttctgcattcctggttcagtattttgatagatatgtttactgtgtcctatgtgcatctctcttttttcc |
27745758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University