View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_low_4 (Length: 368)
Name: NF0410_low_4
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 27312533 - 27312282
Alignment:
| Q |
1 |
atgttctacttcttcatcatttgaaatttgtatactcaattcttgacgattatcttctccttctggtatctgattcgatatcattgtaggctcggtggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312533 |
atgttctacttcttcatcatttgaaatttgtatactcaattcttgacgattatcttctccttctggtatctgattcgatatcattgtaggctcggtggtg |
27312434 |
T |
|
| Q |
101 |
tcaatatcgggtcttggagcaaggttagcacgacaaactgggcaagtatcatgagagacaagccaaatatcgatgcaaccatggtggtacacatggttac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312433 |
tcaatatcgggtcttggagcaaggttagcacgacaaactgggcaagtatcatgagagacaagccaaatatcgatgcaaccatggtggtacacatggttac |
27312334 |
T |
|
| Q |
201 |
atttagggattaaacgcaatgtttcatcgtcttgaaactcattcaaacaaac |
252 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312333 |
atttaggaattaaacgcaatgtttcatcgtcttgaaactcattcaaacaaac |
27312282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 278 - 339
Target Start/End: Complemental strand, 27312230 - 27312169
Alignment:
| Q |
278 |
acgaaaagttgggaatgtgtctataacttcttggttaagaccattacttggctcgttatttt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
27312230 |
acgaaaagttgggaatgtgtctataacttcttggttaagaccgttacttggctcgttgtttt |
27312169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 359 times since January 2019
Visitors: 3059