View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0410_low_6 (Length: 349)
Name: NF0410_low_6
Description: NF0410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0410_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 22 - 311
Target Start/End: Original strand, 6639559 - 6639848
Alignment:
| Q |
22 |
catcataattttcttacaatctcaccttaattattaacatcgtagaccaagcaaaaatggagacacacatctctcgttggtccatcttcgatcaagtaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6639559 |
catcataattttcttacaatctcaccttaattatta-catcgtagaccaagcaaaaatggagaaacacatctctcgttggtccatcttcgatcaagtaga |
6639657 |
T |
 |
| Q |
122 |
tttgcgcaaaatctaattttcactattttggatatgnnnnnnncttacaaaataattgaatttccgtgcttaccgtcattcccnnnnnnngtactacata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6639658 |
tttgcgcaaaatctaattttcactattttggatatgtttttttcttacaaaataattgaatttccgtgcttaccgtcattccctttttttgtactacata |
6639757 |
T |
 |
| Q |
222 |
ttctttatc-tttaagttttaacattcttgaaaagcaaacatgttgaattattttctttatgttcttcaatatatattgaagtttgatgtt |
311 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6639758 |
ttctttatcttttaagttttaacattcttgaaaagcaaacatgttgaattattttctttatgttcttcaatatatattgaagtttgatgtt |
6639848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University