View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_110 (Length: 284)
Name: NF0412_high_110
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_high_110 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 40 - 227
Target Start/End: Complemental strand, 735071 - 734884
Alignment:
Q |
40 |
gtgagatgaagtcaccagaagcacctcaacaagggacaccatgcacttcaatgagcagaaagaaacttggtattttcttcattgagtctgaggatagaag |
139 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
735071 |
gtgagatcaagtcaccagaagcacctcaacaagggacaccatgcacttcaatgagcagaaagaaacttggtattttcttcattgagtctgaggatagaag |
734972 |
T |
 |
Q |
140 |
gatggctttagggcgaggttatacaagaggttctacacctgttaatattcatggaaaatccattgaggatctttcaaaaactggtggt |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
734971 |
gatggctttagggcgaggttatacaagaggttctacacctgttaatattcatggaaaatccattgaggatctttcaaaaactggtggt |
734884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1821 times since January 2019
Visitors: 3091