View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_115 (Length: 281)
Name: NF0412_high_115
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_115 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 14 - 243
Target Start/End: Complemental strand, 27774662 - 27774433
Alignment:
| Q |
14 |
ttctagctcacgaggtgcaatgtcatttgctgctgctgctatggctggactgggatctgccaatagcagaggaatcagagggggaagagaccggcacggg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774662 |
ttctagctcacgaggtgcaatgtcatttgctgctgctgctatggctggacttggatctgccaatagcagaggaatcagagggggaagagaccggcacggg |
27774563 |
T |
|
| Q |
114 |
cgtcccttgtttggtagttctaatgatcctccaaagttaatattcactgctggtgggaaacaattgaacagacagttgactatttatcaagcagttcaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774562 |
cgtcccttgtttggtagttctaatgatcctccaaagttaatattcactgctggtgggaaacaattgaacagacagttgactatttatcaagcagttcaaa |
27774463 |
T |
|
| Q |
214 |
gacagcttgtacaagatgacgatgatgatg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27774462 |
gacagcttgtacaagatgacgatgatgatg |
27774433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1298 times since January 2019
Visitors: 3079