View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_116 (Length: 280)
Name: NF0412_high_116
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_116 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 42 - 192
Target Start/End: Original strand, 46471576 - 46471726
Alignment:
| Q |
42 |
atgaagtgcctgactccaccgtgagttcctttaacttgcatacactttatgaatggtattgtgtgtgtgcctgtgcttgagtatctaatgccaggattct |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46471576 |
atgaagtgcctgactccaccgtgagttcctttaacttgcatacactttatgaatggtattgtgtgtgtgcctgtgcttgagtatctaatgccaggattct |
46471675 |
T |
 |
| Q |
142 |
gtctttttgaaggaaaaatgtttttcaatttaaaagcaggtctaaaaatga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46471676 |
gtctttttgaaggaaaaatgtttttcaatttaaaagcaggcctaaaaatga |
46471726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 42 - 103
Target Start/End: Original strand, 1475250 - 1475311
Alignment:
| Q |
42 |
atgaagtgcctgactccaccgtgagttcctttaacttgcatacactttatgaatggtattgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||| |
|
|
| T |
1475250 |
atgaagtgcctgactccaccgtgagttcctttaacttgcataaactttatgactgttattgt |
1475311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 20743929 - 20743878
Alignment:
| Q |
42 |
atgaagtgcctgactccaccgtgagttcctttaacttgcatacactttatga |
93 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20743929 |
atgaagtgcctgaccccaccgtgagttcctttaacttgcataaactttatga |
20743878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University