View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_120 (Length: 279)
Name: NF0412_high_120
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_120 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 44 - 230
Target Start/End: Original strand, 31338581 - 31338767
Alignment:
| Q |
44 |
agaagagcgcatgctagagcgaagtctttgatggaatttgttggtgtgaggagtggttcgagaaatgctttgacggagatggtggcggttttgggaggag |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31338581 |
agaagagcgcatgctagagcgaagtctttgatggaatttgttggtgtgaggagtggttcgagaaatgctttgacggagatggtggcggttttgggaggag |
31338680 |
T |
|
| Q |
144 |
tgtatgatgttgcggcgagagaggatgtgattgagtttgataaccggaggagagtttcttggagagtggaagatgatgatgatgatg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31338681 |
tgtatgatgttgcggcgagagaggatgtgattgagtttgataaccggaggagagtttcttggagagtggaagatgatgatgatgatg |
31338767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1410 times since January 2019
Visitors: 3084