View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_124 (Length: 278)
Name: NF0412_high_124
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_124 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 30 - 263
Target Start/End: Complemental strand, 33437067 - 33436837
Alignment:
| Q |
30 |
ctattatcctataatactctcttctataccattgtctaaatcggttttagtaatttatagtaacatctaatgctagatctatattaaaatcttgtccaaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33437067 |
ctattatcctataatactctcttctataccattgtctaaatcggtttta---atttatagtaacatctaatgctagatctatattaaaatcttgtccaaa |
33436971 |
T |
|
| Q |
130 |
aataaactaaaatatataatgcaacattcaatgattccgtcgtacccataaaatcttgtctgatagcacttttcaattgtcaaaacaagaagcccacaag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33436970 |
aataaactaaaatatataatgcaacattcaatgattccgtcgtacccataaaatcttgtctgataacacttttcaattgtcaaaacaagaagcccacaag |
33436871 |
T |
|
| Q |
230 |
cgtgatagtaaactgttggaaagatttacacgtc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33436870 |
cgtgatagtaaactgttggaaagatttacacgtc |
33436837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1745 times since January 2019
Visitors: 3091