View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_129 (Length: 274)
Name: NF0412_high_129
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_129 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 55 - 244
Target Start/End: Complemental strand, 41824206 - 41824020
Alignment:
| Q |
55 |
gaagcaactggttttgtaggtggtgagaaaggaaacagcacatagttttggttagtgtgtgttttggaataataataagccacaagttttgtgtaaaact |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41824206 |
gaagcaactggttttgtaggtggtgagaaaggaaacagcacatagttttggttagtgtgtgttttggaataataa---gccacaagttttgtgtaaaact |
41824110 |
T |
 |
| Q |
155 |
ggttgagcttactacttttactaccacgtccactgaaacgccgtttcaaagcgcgaacaatgatggattttatatacgtgtttcttttca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41824109 |
ggttgagcttactacttttactaccacgtccactgaaacgccgtttcaaagcgcgaacaatgatggattttgtatacgtgtttcttttca |
41824020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University