View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_133 (Length: 271)
Name: NF0412_high_133
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_133 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 34 - 221
Target Start/End: Original strand, 26859766 - 26859953
Alignment:
| Q |
34 |
gaagcggaagagtaaggagtggaaggtttccggtgagagaacggtgagttgctcggtgctcgtgaagacgaagccattgagtcaactcgccgagttagtt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26859766 |
gaagcggaagagtaaggagtggaaggtttccggtgagagaacggtgagttgctcggtgctcgtgaagacgaagccattgagtcaactcgccgagttagtt |
26859865 |
T |
|
| Q |
134 |
agaagaaaatggtaaaatgtggagtgaaggaggaagaaaggttaaggaagaggaatagaatgtgtcaggattttcacatggaaacaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26859866 |
agaagaaaatggtaaaatgtggagtgaaggaggaagaaaggttaaggaagaggaatagaatgtgtcaggattttcacatggaaacaaa |
26859953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 113
Target Start/End: Original strand, 54895390 - 54895472
Alignment:
| Q |
31 |
gatgaagcggaagagtaaggagtggaaggtttccggtgagagaacggtgagttgctcggtgctcgtgaagacgaagccattga |
113 |
Q |
| |
|
||||||| ||||||||||| || || |||||||||||||| ||||||||| | || ||||||| ||||| || |||||||| |
|
|
| T |
54895390 |
gatgaagttgaagagtaaggtgttgatggtttccggtgagaaaacggtgagctacttcgtgctcgagaagaagacgccattga |
54895472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1586 times since January 2019
Visitors: 3090