View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_134 (Length: 270)
Name: NF0412_high_134
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_high_134 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 42737893 - 42737691
Alignment:
Q |
31 |
atgaagttcatgtgaggagggatt---gttataagctgtaactgagatcccaagggatcattttcttttcctctaactgcgccatacttgatgatcatca |
127 |
Q |
|
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42737893 |
atgaagttcatgtgaggagggaattgtgttataagctgtaactgagatcccaagggatcattttcttttcctctaactgcgccatacttgatgatcatca |
42737794 |
T |
 |
Q |
128 |
aaacgtgtatttcaaaactactagctaagtatcaataaaaaagcagcactgcatgagaaaaattacaactactatgatttatttcaagtaaaaacgatgt |
227 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
42737793 |
aaacgtgtatttcaaaactactagctaagtatcaataaaaaagaagcactgcatgagaaaaattacaactactatgatttattcgaagtaaaaacgatgt |
42737694 |
T |
 |
Q |
228 |
act |
230 |
Q |
|
|
||| |
|
|
T |
42737693 |
act |
42737691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University