View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_135 (Length: 270)
Name: NF0412_high_135
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_high_135 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 36 - 209
Target Start/End: Complemental strand, 1221474 - 1221304
Alignment:
Q |
36 |
ctatatatgaatgtttattgttatgagcaaagtttgctcccnnnnnnnnnnngtctatttggcattttattactattccatattattaatgactacccaa |
135 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
1221474 |
ctatatatgaatgtttattgttatgagcaaagtttgctccctttttttt---gtctatttggcattttattactattcgatattattaatgactacccaa |
1221378 |
T |
 |
Q |
136 |
caatgatcgtcttttcttttatacaaactcaacaatgatcattatagaggatggtatgcaacctttatcattat |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1221377 |
caatgatcgtcttttcttttatacaaactcaacaatgatcattatagaggatggtatgcaacctttatcattat |
1221304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 98 - 209
Target Start/End: Original strand, 41987108 - 41987219
Alignment:
Q |
98 |
cattttattactattccatattattaatgactacccaacaatgatcgtcttttcttttatacaaactcaacaatgatcattatagaggatggtatgcaac |
197 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41987108 |
cattttattactattcgatattattaatgactacccaacaatgatcgtcttttcttttatacaaactcaacaatgatcattatagaggatggtatgcaac |
41987207 |
T |
 |
Q |
198 |
ctttatcattat |
209 |
Q |
|
|
|||||||||||| |
|
|
T |
41987208 |
ctttatcattat |
41987219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 36 - 76
Target Start/End: Original strand, 41986963 - 41987002
Alignment:
Q |
36 |
ctatatatgaatgtttattgttatgagcaaagtttgctccc |
76 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
41986963 |
ctatatatgaatgtttattgttatgagcaaa-tttgctccc |
41987002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University