View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_140 (Length: 267)
Name: NF0412_high_140
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_140 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 40 - 218
Target Start/End: Original strand, 23283920 - 23284097
Alignment:
| Q |
40 |
gagttggggttacgagagtgaagagtatgttgttata--tatatacggaagcatggttgggtttatttgaagagtgtaagtgtgtgtgtttcgtgtgagt |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23283920 |
gagttggtgttacgagagtgaagagtatgttgttatatatatatacggaagcatggttgggtttatttgaagagtgtaagtgtgtgtgtttcgtgtgagt |
23284019 |
T |
|
| Q |
138 |
tggatattttagaattgtaaactgtttaagaagccaggtggttggttattataggttttgtgattggtcattggctataat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||| |||||||||||||| |
|
|
| T |
23284020 |
tggatattttagaattgtaaactgtttaagaagccaggtggttgg---ttatagctattgtgattgctcattggctataat |
23284097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 23290349 - 23290398
Alignment:
| Q |
132 |
gtgagttggatattttagaattgtaaactgtttaagaagccaggtggttgg |
182 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
23290349 |
gtgatttggatattttagaattgt-aactgtgtaagaagccaggtggttgg |
23290398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1621 times since January 2019
Visitors: 3090