View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_156 (Length: 260)
Name: NF0412_high_156
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_156 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 22 - 223
Target Start/End: Original strand, 5659905 - 5660107
Alignment:
| Q |
22 |
aagaggcacacggcacacccc-tttttcatccacgtgtcacaaacattnnnnnnntaacaccacttcatagcaaaacgctgcgtttcacagtgagctgca |
120 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5659905 |
aagaggcacacggcacaccccctttttcatccacgtgtcacaaacattaaaaaaataacaccacttcatagcaaaacgctgcgtttcacagtgagctgca |
5660004 |
T |
|
| Q |
121 |
agtgttggggatctccgattcagttttcagttaggcgcaactgtttccgttgtctgaaatattcatcactccaaccgatccaaaatcaacccaatttcat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5660005 |
agtgttggggatctccgattcagttttcagttaggcgcaactgtttccgttgtctgaaatattcatcactccaaccgatccaaaatcaacccaatttcat |
5660104 |
T |
|
| Q |
221 |
tct |
223 |
Q |
| |
|
||| |
|
|
| T |
5660105 |
tct |
5660107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1075 times since January 2019
Visitors: 3075