View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_158 (Length: 258)
Name: NF0412_high_158
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_158 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 30 - 247
Target Start/End: Original strand, 47137978 - 47138195
Alignment:
| Q |
30 |
attcacccatcgattctcttcaagaagatgaccaattactatacaagcacatagcaatgccacaaataggttcatagagattatggatgcataatccgaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47137978 |
attcacccatcgattctcttcaagaagatgaccaattactatacaagcacatagcaatgccacaaataggttcatagagattatggatgcataatccgaa |
47138077 |
T |
|
| Q |
130 |
gtggttaacatttgaagtgattcaacacccatttttctcaaccctcaatgattataattcgtgcaatcaaattcgcattttattataaagttcagcttca |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
47138078 |
gtggttaacatttgaagtgattcaacacccatttttctcaaccctcaatgattataatttgtgcaatcacattcacattttattataaagttcagcttca |
47138177 |
T |
|
| Q |
230 |
cttaatccatgcatctgt |
247 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47138178 |
cttaatccatgcatctgt |
47138195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 30 - 107
Target Start/End: Complemental strand, 36488272 - 36488195
Alignment:
| Q |
30 |
attcacccatcgattctcttcaagaagatgaccaattactatacaagcacatagcaatgccacaaataggttcataga |
107 |
Q |
| |
|
||||| ||| |||||||| || ||||||||||||| || ||||||||||| || | ||||||||| | ||||||||| |
|
|
| T |
36488272 |
attcatccagcgattctcctcgagaagatgaccaaggacaatacaagcacacagaagtgccacaaacaagttcataga |
36488195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 516 times since January 2019
Visitors: 3060