View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_163 (Length: 254)
Name: NF0412_high_163
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_163 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 28 - 254
Target Start/End: Complemental strand, 22383048 - 22382822
Alignment:
| Q |
28 |
caaccataacttcgatatcagtacccattagagctgtcaaaatggtatcatcagcatcaaaaagcttcaattttcgaaacccgttgtccttaagcatctt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22383048 |
caaccataacttcgatatcagtacccattagagctgtcaaaatggtatcatcagcatcaaaaagtttcaattttcgaaacccgttgtccttaagcatctt |
22382949 |
T |
|
| Q |
128 |
cacaactttcttaggtggaagttggtgggttgtcattgttccccagtttacaccaacccaagcagaggaagatgagattatggttaggaagatgatgagg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22382948 |
cacaactttcttaggtggaagttggtgggttgtcattgttccccagtttacaccaacccaagcagaggaagatgagattatggttaggaagatgatgagg |
22382849 |
T |
|
| Q |
228 |
aatgttgctaggtatatgcaatatgat |
254 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
22382848 |
aatgttgctaggtatatgcaatttgat |
22382822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1370 times since January 2019
Visitors: 3081