View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_166 (Length: 252)
Name: NF0412_high_166
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_166 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 34588260 - 34588030
Alignment:
| Q |
1 |
tttaaaaaagcatgccatacatgttgatagcaatgcacatggtctggcatctgcccttgttctttttctctctgtcaagatggacacgtaattgaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34588260 |
tttaaaaaagcatgccatacatgttgatagcaatgcacatggtctggcatctgcccttgttctttttctctccgtcaagatggacacgtaattgaataaa |
34588161 |
T |
|
| Q |
101 |
gttggatgtatattttcatatgtactttttgtttaaaattgtaatacatacgtgatgctaaaatcttcatcttaatttttatcaaatttattcctgctat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34588160 |
gttggatgtatattttcatatgtactttttgtttaaaattgtaatacatacgtgatgctaaaatcttcatcttaatttttatcaaatttattcctgctat |
34588061 |
T |
|
| Q |
201 |
tttagggaggagtacgtccttgatgatgatg |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
34588060 |
tttagggaggagtacgtccttgatgaagatg |
34588030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 980 times since January 2019
Visitors: 3074