View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_171 (Length: 250)
Name: NF0412_high_171
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_high_171 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 77
Target Start/End: Original strand, 1429282 - 1429329
Alignment:
Q |
30 |
gatttgggtattagggtttgtgaattcaattctaattatttgttgtga |
77 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1429282 |
gatttcggtattagggtttgtgaattcaattctaattatttgttgtga |
1429329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University