View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_high_171 (Length: 250)

Name: NF0412_high_171
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_high_171
NF0412_high_171
[»] chr3 (1 HSPs)
chr3 (30-77)||(1429282-1429329)


Alignment Details
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 77
Target Start/End: Original strand, 1429282 - 1429329
Alignment:
30 gatttgggtattagggtttgtgaattcaattctaattatttgttgtga 77  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||    
1429282 gatttcggtattagggtttgtgaattcaattctaattatttgttgtga 1429329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1225 times since January 2019
Visitors: 3078