View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_high_193 (Length: 232)

Name: NF0412_high_193
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_high_193
NF0412_high_193
[»] chr6 (1 HSPs)
chr6 (142-204)||(24737863-24737925)


Alignment Details
Target: chr6 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 142 - 204
Target Start/End: Complemental strand, 24737925 - 24737863
Alignment:
142 aactttgcaagtagatgcataggtgaattaaagttgattttttgacttgaagaagttaactat 204  Q
    ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
24737925 aactttgcaagtagatgcataagtgaactaaagttgattttttgacttgaagaagttaactat 24737863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1303 times since January 2019
Visitors: 3079