View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_197 (Length: 227)
Name: NF0412_high_197
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_197 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 33647299 - 33647442
Alignment:
| Q |
1 |
tgttgatgaagtagggttatggtatggaaggaaggttggatcaaaggaaatgggatatgaagagaggacacctcttatggtaggtgctttatatggaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33647299 |
tgttgatgaagtagggttatggtatggaaggaaggttggatcaaaggaaatgggatatgaagagaggacacctcttatggtagctgctttatatggaagc |
33647398 |
T |
|
| Q |
101 |
aagggtgtgttgtcttatattctcggaaccggtcgtgatgatgt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33647399 |
aagggtgtgttgtcttatattctcggaaccggtcgtgttgatgt |
33647442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 5 - 145
Target Start/End: Original strand, 25812122 - 25812262
Alignment:
| Q |
5 |
gatgaagtagggttatggtatggaaggaaggttggatcaaaggaaatgggatatgaagagaggacacctcttatggtaggtgctttatatggaagcaagg |
104 |
Q |
| |
|
||||| ||||| |||||||||||||| | ||||||||| ||||| |||||||||||||||||||| |||||||||| | ||| |||| ||||||||||| |
|
|
| T |
25812122 |
gatgaggtaggattatggtatggaagaagggttggatcgaaggatatgggatatgaagagaggacggctcttatggttgctgccttatttggaagcaagg |
25812221 |
T |
|
| Q |
105 |
gtgtgttgtcttatattctcggaaccggtcgtgatgatgtc |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
25812222 |
gtgtgttgtcttatattctcggaaccagtcgtgttgatgtc |
25812262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 25817791 - 25817927
Alignment:
| Q |
1 |
tgttgatgaagtagggttatggtatggaaggaaggttggatcaaaggaaatgggatatgaagagaggacacctcttatggtaggtgctttatatggaagc |
100 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| ||||||||||||||||| | |||||||| ||||| ||||||||| | | ||| || | ||||||| |
|
|
| T |
25817791 |
tgttgatgaagtaggattgtggtatggaaggaagattggatcaaaggaaatgagttatgaagaaaggacccctcttatgattgctgccttgtttggaagc |
25817890 |
T |
|
| Q |
101 |
aagggtgtgttgtcttatattctcggaaccggtcgtg |
137 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25817891 |
aagggtgtgttgtcttatattcttggaaccggtcgtg |
25817927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 144
Target Start/End: Original strand, 30121749 - 30121873
Alignment:
| Q |
20 |
tggtatggaaggaaggttggatcaaaggaaatgggatatgaagagaggacacctcttatggtaggtgctttatatggaagcaagggtgtgttgtcttata |
119 |
Q |
| |
|
|||||||||||||| ||||| ||||| || | || |||||||||||||||||||| ||||| | |||| | |||||||| || ||| | | |||||| |
|
|
| T |
30121749 |
tggtatggaaggaacgttggttcaaacaaatttggttatgaagagaggacacctctcatggttgctgctatgtatggaagtttggatgtatcggcttata |
30121848 |
T |
|
| Q |
120 |
ttctcggaaccggtcgtgatgatgt |
144 |
Q |
| |
|
|||| ||||| ||||| | |||||| |
|
|
| T |
30121849 |
ttcttggaacaggtcgggttgatgt |
30121873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1661 times since January 2019
Visitors: 3091